Mitra Global CMS Mitra Global CMS Mitra Global CMS
 
تعیین جنسیت قناری با استفاده از روش PCR
چکيده:
تعيين جنسيت اغلب پرندگان تا زمان بلوغ و حتي گاهي بعد از بلوغ امري نسبتا مشکل است. اما جنسيت پرندگان و ساير جانوران از بدو تشکيل نطفه، به لحاظ ژنتيکي معين است. امروزه با پيشرفت روش هاي مولکولي، تعيين جنسيت جانداران در هر مرحله از زندگي ميسر مي باشد. در تحقيق حاظر تعيين جنسيت در قناري با استفاده از واکنش
PCR و براساس دو ژن CHD-W و CHD-Z شرح داده شده است. در اين تحقيق جمعا از 29 قطعه قناري استفاده شد. استخراج DNA از انتهاي کالاموس پر قناري هاي زنده صورت پذيرفت و با استفاده از پرايمرهاي اختصاصي طراحي شده در اين طرح، واکنش PCR تنظيم گرديد. نتايج نشان دهنده تکثير دو قطعه DNA به طول هاي 345 و 306 جفت باز براي جنس ماده و فقط يک باند 306 جفت باز براي جنس نر بود. اين نتايج براي كليه نمونه هاي پر مشاهده شد. از آنجا که طراحي اين سيستم تعيين جنسيت براي اولين بار در قناري مورد استفاده قرار مي گيرد و نتايج مولکولي با ويژگي هاي مورفولوژيک دو جنس نر و ماده کاملا مطابقت دارد، لذا تعيين جنسيت جوجه هاي قناري با انجام واكنش PCR روي نمونه هاي پر، آسان، سريع، بي خطر و ارزان مي باشد.

مقدمه:
قناري ها (
Serinus canaria canaria) از جمله زيباترين پرندگان خانگي هستند که از زمان هاي بسيار دور نگهداري آنها به خاطر آواز دلنشين و رنگ آميزي زيبايشان رايج شده و مورد توجه مردم سراسر دنيا قرار گرفته است. طبق دسته بندي سيستماتيک زيست شناسي، قناري وحشي به راسته گنجشک ها (Passeriformes) و به خانواده فنچ ها (Fringillidae) تعلق دارند. با توجه به اينکه قناري ها از زمان بلوغ شروع به آواز خواندن مي کنند و صداي زيباي قناري ها بيشتر توسط جنس نر توليد مي شود، به همين دليل جنس نر اين پرنده نسبت به جنس ماده از لحاظ اقتصادي داراي ارزش بيشتري است و با قيمت افزون تري نسبت به جنس ماده به فروش مي رسد (1، 2و 3). يكي از بهترين راه ها براي تمايز دادن پرندگان نر و ماده استفاده از روشهاي مولکولي بر اساس DNA است. يافتن يك نشانگر مولکولي مناسب براي تعيين جنسيت، كاري دشوار است. از آنجا كه ژنوتيپ پرنده ماده ZW و ژنوتيپ پرنده نر ZZ مي باشد، لذا كروموزوم W فقط در جنس ماده پرندگان وجود دارد و بر اساس آن مي توان ماركر ژنتيكي مناسبي براي تفكيك جنس هاي نر و ماده از هم يافت. اين ويژگي همانند کروموزوم Y در انسان است با اين تفاوت که در انسان و ساير پستانداران، جنس نر هتروگامتيک است و جنس ماده هموگامتيک مي باشد ولي در پرندگان وضعيت دقيقا عکس است (4و5). برخي از ژنهاي موجود بر روي کروموزوم W بسيار حفظ شده بوده و با استفاده از اين گونه ژن ها مي توان در تمام گونه هاي پرندگان، جنسيت پرنده را با استفاده از يك جفت پرايمر و طي يک مرحله انجام واكنش PCR تعيين كرد (6). در برخي از پرندگان، نظير پرندگان عظيم الجثه مانند شترمرغ، پرايمرهاي مربوط به ژن CHD، سبب تکثير قطعاتي در هر دو ژن CHD-W و CHD-Z مي گردد زيرا اين پرايمر ها همزمان با هم قسمت هاي هومولگ از ژن CHD-W و ژن مرتبط آن يعني CHD-Z را تکثير مي نمايند اما در اين قطعات تکثير شده، تفاوت طول مشاهده مي گردد و از همين خاصيت مي توان به منظور تعيين جنسيت پرندگان بهره گرفت (7و8). هدف از اين تحقيق تنظيم روش PCR براي تعيين جنسيت قناري براي اولين بار با پرايمرهاي جديد طراحي شده مي باشد.

مواد و روش كار:
به منظور تعيين جنسيت قناري جمعا از 29 قطعه قناري نمونه گيري به عمل آمد. نمونه گيري از انتهاي كالاموس پر قناري هاي زنده (11 ماده و 6 نر و12 جوجه قناري با جنسيت نامعلوم) صورت گرفت و‌
DNA ي ژنومي با استفاده از روش استاندارد فنل-كلروفرم استخراج گرديد و جهت اطمينان از كيفيت DNA و مشاهده قطعات DNAي استخراج شده از ژل آگارز 1 درصد و رنگ آميزي توسط اتيديوم برمايد استفاده شد، همچنين کيفيت DNA استخراج شده توسط دستگاه اسپکتروفوتومتر نيز بررسي گرديد. به منظور انجام PCR، نياز به پرايمرهاي اختصاصي تعيين جنسيت مي باشد که بر اساس ژن CHD قناري طراحي گردند. اما پس از انجام مطالعات بسيار، توالي ژن CHD قناري يافت نشد لذا به منظور طراحي پرايمر از توالي ژن CHD-W مربوط به پرنده اي با نام علمي Hemispingus frontalis که از خانواده Fringillidae مي باشد و قرابت فيلوژنتيکي بالايي با Serinus canaria دارد، استفاده شد. توالي پرايمرهاي طراحي شده براي اين تحقيق به صورت زير است:

Canary-F: 5'- GGATGAGGAACTGTGCAAAAC -3'

Canary-R: 5'- AATAGTTCGCGGTCTTCCAC -3'

براي انجام واكنش
PCR حجم نهايي واكنش 25 ميكروليتر بوده كه شامل: 20 نانوگرم DNA الگو، 2 ميلي مولار MgCl2، 25 پيکومول از هر پرايمر، 1 واحد آنزيم DNA پليمراز Taq و200 ميکرو مولار dNTP Mix بود. براي انجام واكنش PCR از دستگاه مسترسايكلر گرادينت شركت Eppendorf استفاده شد. برنامه ي حرارتي مورد استفاده شامل: 95 درجه سانتي گراد 5 دقيقه، سپس 30 چرخه دمايي به ترتيب 94 درجه سانتي گراد 1 دقيقه، 58 درجه سانتي گراد 1 دقيقه و 72 درجه سانتي گراد 1 دقيقه و يک مرحله نهايي 72 درجه سانتي گراد 5 دقيقه تنظيم گرديد. سپس محصولات PCR با ژل آگارز 5/1 درصد الكتروفورز گرديد و توسط اتيديوم برمايد رنگ آميزي شد و با استفاده از نور UV مورد ارزيابي قرار گرفت.

نتايج و بحث:
از کالاموس پر پرندگان مورد آزمايش،
DNAي ژنومي با موفقيت استخراج گرديد و كيفيت DNA ي استخراج شده با استفاده از روش طيف سنجي و الكتروفورز روي ژل آگارز 1 درصد تعيين گرديد. سپس غلظت DNA استخراج شده به ميزان ng/μl 20 تنظيم شد. انجام PCR با پرايمرهاي اختصاصي طراحي شده ي تعيين جنسيت در قناري و مشاهده ي نتايج حاصل بر روي ژل آگارز 5/1 درصد نشان دهنده تکثير دو قطعه DNA به طول هاي 345 و 306 جفت باز براي جنس ماده و يک باند 306 جفت باز براي جنس نر بود كه در ژل آگارز مشاهده مي شود.
نتايج حاصل نشان مي دهد، تعيين جنسيت قناري با استفاده از اين روش، بسيار سريع، دقيق و کم هزينه بوده و در هر دوره از زندگي اين پرنده مي تواند بکار رود. از آنجایی که تعیین جنسیت پرندگان با استفاده از روش های قدیمی مانند لمس کلواک، سنجش میزان استروئید، کاریوتایپینگ و... دشوار و زمانبر می باشد و حتی در برخی موارد موجب مرگ پرنده می شود(9) لذا محققين متعددي تا کنون در راستاي تعيين جنسيت مولکولي موجودات تلاش نموده اند و برخي نيز به نتايج مطلوبي دست يافته اند. براي مثال در سال 1998
Griffiths و همکاران با استفاده از دو ژن CHD-W و CHD-Z و طراحي پرايمر هاي متعدد، به تعيين جنسيت گروهي از پرندگان (شتر مرغ، قو، کبوتر، غاز وحشی و ...) پرداخته اند (10). در سال 2000، Nesje و همکاران سعی کردند با استفاده از دو جایگاه میکروستلایتی، پرندگانی از قبیل شاهین، باز وحشی، قوش و غیره را تعیین جنسیت نمایند اما این روش در تعیین جنسیت برخی از پرندگان مورد آزمایش موفقيت آميز نبود (11). همچنين در سال 2004، Agate و همکاران براي تعيين جنسيت Zebra Finches از ژن CHD1-Z و CHD1-W استفاده کردند (12). در اين تحقيق با توجه به اينکه توالي ژنهاي CHD-W و CHD-Z مربوط به قناري در بانک ژن جهاني ثبت نگرديده اند، لذا همان طور که در بالا اشاره شد، از روي توالي ژن CHD-W مربوط به پرنده اي شبيه به قناري، ترتيب نوكلئوتيدي پرايمرها انتخاب و نتايج مطلوبي در مورد تعيين جنسيت قناري بدست آمد. اين سيستم تعيين جنسيت مولکولي بر اساس PCR که براي قناري ماده دو قطعه DNA و براي قناري نر، يک قطعه DNA تکثير مي نمايد براي اولين بار تنظيم و معرفي مي گردد.
تشکر و قدرداني
بدين وسيله از حوزه معاونت پژوهشي دانشگاه آزاد اسلامي واحد شهرکرد و همچنين کليه همکاران مرکز تحقيقات بيوتکنولوژي دانشگاه تقدير و تشکر به عمل مي آيد.
منابع:
1- فرشچي ع. (1362). قناري: نگهداري، تغذيه، بيماري ها، تکثير و پرورش، آوازخواني و شناخت حالات، اتوفون فريش(مولف). چاپ نهم. تهران: موسسه انتشاراتي روزبهان، 1362؛ 45-7.
2-
Takagi N, Itoh M and Sasaki M (1972) Chromosome studies in four species of
ratitae (Aves). Chromosoma, 36: 281-291.
3-
Jensen T, Pernasetti FM and Durrant B (2003) Conditions for rapid sex determination in 47 avian species by PCR of genomic DNA from blood, shell-membrane blood vessels and feathers. Zoo Biology, 22: 561-567.
4-
Stefos K and Arrighi FE. (1971) Heterochromatic nature of W chromosomes in birds Experimental Cell Research, 68: 228-231.
5-
Gubbay J, Collignon J, Koopman P, Capel B, Economou A, Munsterberg A, Vivian N, Goodfellow P and Lovell-Badge R (1990) A gene mapping to the sex-determining region of the mouse Y chromosome is a member of a novel family of embryonically expressed genes. Nature, 346, 245–250.
6-
Griffiths R and Tiwari B (1996) Avian CHD genes and their use in methods in sex identification of birds. International patent publication, WO9639505.
7-
Griffiths R and Korn R (1997) A CHD1 gene is Z chromosome linked in the chicken Gallus domesticus. Gene, 197: 225-229.
8-
Bermúdez-Humarán LG, García-García A, Leal-Garza CH, Riojas-Váldez V, Jaramillo-Rangel G and Montes-de-Oca-Luna R (2002) Molecular sexing of monomorphic endangered Ara birds. Journal of Experimental Zoology, 292: 677–680.
9-
Cerit H and AvanusK (2007) Sex identification in avian species using DNA typing methods. World’s Poultry Science Association, 63: 91-99.
10-
Griffiths R, Double MC, Orr K and Dawson RJG (1998) A DNA test to sex most birds. Molecular Ecology, 7: 1071-1075.
11-
Nesje M and Roed K (2000) Sex identification in falcons using microsatellite DNA markers. Hereditas, 132: 261-263.
12-
Agate RJ, Choe M and Arnold AP (2004) Sex Differences in Structure and Expression of the Sex Chromosome Genes CHD1Z and CHD1W in Zebra Finches. Molecular Biology and Evolution, 21(2): 384-396.
سعادت مشكلاني
 
 
Mitra Global CMS Mitra Global CMS Mitra Global CMS